AGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAAC
Sarah J. Wheelan, MD, PhD

Assistant Professor,
Oncology Biostatistics and Bioinformatics
The Johns Hopkins University School of Medicine

Co-director, Next Generation Sequencing Center (NGSC) at the Sidney Kimmel Comprehensive Cancer Center

Physical location:
David H. Koch Cancer Research Building 2, Room 146
1550 Orleans Street, Baltimore,MD, 21231

Mailing address:
550 N. Broadway, Suite 1101
Baltimore, MD 21205

410.502.7754
swheelan@jhmi.edu