AGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAAC

Publications: data downloads


Mularoni L, Zhou Y, Bowen T, Gangadharan S, Wheelan SJ* Boeke JD*. Retrotransposon Ty1 integration targets specifically positioned asymmetric nucleosomal DNA segments in tRNA hotspots.

CTY viewer
S. cerevisiae genome with Ty elements removed: yeast_genome_noTy.fa
Feature file for the noTy genome: SGD_yeast_features_noTy_v2.tab




Gangadharan S*, Mularoni L*, Fain-Thornton J, Wheelan SJ*, Craig NL*. DNA transposon Hermes inserts into nucleosome free regions. Proc Natl Acad Sci U S A. 2010 Dec 21. PubMed

sd01_invitro.txt
sd01_invivo.txt