AGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAAC

The Lab (currently seeking a postdoctoral fellow)

  • Lauren Schenk Ciotti, Communications Associate, Center for Computational Genomics and Next Generation Sequencing Center, SKCCC
  • Paul Schaughency, PhD, postdoctoral fellow
  • Bracha Erlanger, Human Genetics graduate student, co-advised with Ben Park
  • Heather Wick, Human Genetics graduate student
  • Alyza Skaist, MS, research analyst in Oncology Next Generation Sequencing Center
  • Anuj Gupta, MS, research analyst in Oncology Next Generation Sequencing Center
    Didn't survive their rotations but will live on in future projects:
  • Two Triops longicaudatus