AGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAAC

Current Projects include

  • Second- and third-generation sequencing (alignment, data analysis, mapping)
  • Spatial relationships of genomic features and functional correlates
  • RNAseq analysis
  • Genometric Correlation
  • Transposon mapping and transposon expression analysis
  • Sequence biology: motifs, sequence content etc.