AGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAAC

Publications

Selected Original Research Articles (click here for full list link from NCBI)

Lee SS, Bohrson C, Pike AM, Wheelan SJ, Greider CW. ATM Kinase is required for telomere elongation in mouse and human cells. Cell Rep. 2015 Nov. PubMed

Wilton R, Budavari T, Langmead B, Wheelan SJ, Salzberg SL, Szalay AS. Arioc: high-throughput read alignment with GPU-accelerated exploration of the seed-and-extend search space. PeerJ. 2015 PubMed

Harr JC, Luperchio TR, Wong X, Cohen E, Wheelan SJ, Reddy KL. Directed targeting of chromatin to the nuclear lamina is mediated by chromatin state and A-type lamins. J Cell Biol. 2015 PubMed

Wu H, Luo J, Yu H, Rattner A, Mo A, Wang Y, Smallwood PM, Erlanger B, Wheelan SJ, Nathans J. Cellular resolution maps of x chromosome inactivation: implications for neural development, function, and disease. Neuron. 2014; 81(1):103-19. PubMed

O’Donnell KA, An W, Schrum CT, Wheelan SJ, Boeke JD. Controlled insertional mutagenesis using a LINE-1 (ORFeus) gene trap mouse model. Proc Natl Acad Sci USA July 2013 PubMed

Babcock JJ, Du F, Xu K, Wheelan SJ, Li M. Integrated analysis of drug-induced gene expression profiles predicts novel hERG inhibitors. PLoS One. 2013 Jul PubMed

Cheng W-C, Kingsbury TJ, Wheelan SJ, Civin CI. A simple high-throughput technology enables gain-of-function screening of human microRNAs. Biotechniques 2013 Feb. PubMed

Favorov A, Mularoni L, Cope LM, Medvedeva Y, Mironov AA, Makeev VJ, Wheelan SJ. Exploring Massive, Genome Scale Datasets with the GenometriCorr Package. PLoS Computational Biology. 2012 May;8(5):e1002529. PubMed

Mularoni L, Zhou Y, Bowen T, Gangadharan S, Wheelan SJ*, Boeke JD*. Retrotransposon Ty1 integration targets specifically positioned asymmetric nucleosomal DNA segments in tRNA hotspots. Genome Res. 2012 Jan 9 PubMed

Tyekucheva S, Yolken R, McCombie R, Parla J, Kramer M, Wheelan SJ*, Sabunciyan S*. Establishing the baseline level of repetitive element expression in the human cortex. BMC Genomics. 2011 Oct 10;12(1):495 PubMed

Sobreira NLM, Gnanakkan V, Walsh M, Marosy B, Wohler E, Thomas G, Hoover-Fong JE, Hamosh A, Wheelan SJ, Valle D. Characterization of Complex Chromosomal Rearrangements by Targeted Capture and Next-Generation Sequencing. 2011 Genome Research, epub September 2, 2011. PubMed

Gangadharan S*, Mularoni L*, Fain-Thornton J, Wheelan SJ*, Craig NL*. DNA transposon Hermes inserts into nucleosome free regions. Proc Natl Acad Sci U S A. 2010 Dec 21. PubMed

Wheelan SJ, Scheifele LZ, Martínez-Murillo F, Irizarry RA, Boeke JD. The Transposon site Insertion Profiling Chip (TIP-chip). Proceedings of the National Academy of Sciences, 2006 Nov 21;103(47):17632-7. PubMed

Wheelan SJ, Martínez-Murillo F, Irizarry RA, Boeke JD. Stacking the deck: double-tiled DNA microarrays. NatureMethods, 2006 Nov;3(11):903-7 PubMed

Wheelan SJ, Aizawa Y, Han JS, Boeke JD. Gene-breaking: a new paradigm for human retrotransposon-mediated gene evolution. Genome Research 2005 Aug;15(8):1073-8. PubMed

Wheelan SJ, Church DM, Ostell JM. Spidey &mdash a tool for mRNA-to-genomic alignments. Genome Research 2001 Nov; 11:1952-1957. PubMed

Wheelan SJ, Boguski MS, Duret L, Makalowski W. Human and nematode orthologs — lessons from the analysis of 1800 human genes and the proteome of Caenorhabditis elegans. Gene 1999 Sep 30;238(1):163-70. PubMed

Book Chapters

Wheelan SJ. Genome-scale analysis of data from high-throughput technologies. In Modern Molecular Biology: Approaches for Unbiased Discovery in Cancer Research. Yegnasubramanian, Srinivasan; Isaacs, William B. (Eds.) Applied Bioinformatics and Biostatistics in Cancer Research (series editors Jeanne Kowalski, Steven Piantadosi). First Edition 2010

Boeke JD, An W, Dai L, Davis ES, Han JS, O'Donnell KA, Scheifele LZ, Wheelan SJ Retrotransposons &mdash Natural and Synthetic. In Retrotransposition, Diversity and the Brain. Fred Gage (Editor), Yves Christen (Editor) First Edition, 2007.

Kans J, Wheelan SJ, and Ostell J. The NCBI Data Model. In Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins. Andreas Baxevanis(Editor), B.F.Francis Ouellette (Editor) 2nd Edition, 2001.


Editorials

Wheelan SJ, Martínez-Murillo F, Boeke JD. The incredible shrinking world of DNA microarrays. Molecular BioSystems 2008 Jul; 4(7):726-32. Epub 2008 Apr 17. PubMed

Wheelan S, Makalowski W. Genome research: the second decade. A report on the XI Cold Spring Harbor Laboratory Meeting on Genome Mapping and Sequencing, May 13-17, 1998, Cold Spring Harbor, NY. Comput Chem. 2000 Jan;24(1):125-7. PubMed

Wheelan SJ, Boguski MS. Late-night thoughts on the sequence annotation problem. Genome Research 1998 Mar;8(3):168-9. PubMed