AGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAACAGCGCCCGCGCCCACTGGCACGAGGAGCTGGCCAAC

Research in Computational biology, genomics, and sequence alignment

The basic question: how does DNA work? DNA, plus epigenetic factors, has enough information to operate a complex organism. We really don't know much about how this works.

Our current projects are diverse but at the core they share a focus on creating new techniques for mathematical analysis and biological interpretation of high-throughput sequencing data and other high-dimensional biological datasets. Since sequence analysis is a very broadly applicable technique, we have been involved in projects ranging from analyses of cancer genomes to in-depth analysis of the dog transcriptome, to mapping transposon insertions using sequencing methods in several organisms.

The common theme in this research is that DNA sequence guides DNA structure, which in turn restricts and enables gene function. Looking at spatial relationships across genomes and using transpsosons to query genomic sequence/structure relationships are two ways to address these questions.

Current projects:
  • Second- and third-generation sequencing (alignment, data analysis, mapping)
  • Spatial relationships of genomic features and functional correlates
  • RNAseq analysis
  • Genometric Correlation
  • Transposon mapping and transposon expression analysis
  • Sequence biology: motifs, sequence content etc.